Artificial micro-rna designing for epigenetic blockade interference with il-12 in pathogenesis of auto-immune disorders

Kambiz Banihashemi,1,* Leila.alimardanian,2 Abouee mehrizii s,3 Ebrahimi p,4 Jamshidabadi sh,5

1. MD, ATU, MSRT
2. PhD, SRBIAU, Department of molecular genetics
3. MD, Parseh Medical Genetics Clinic
4. PhD, Parseh Medical Genetics Clinic
5. 5. MSC, Parseh Medical Genetics Clinic

Abstract

Introduction

Interleukins, such as il-12, play a role in the pathogenesis of autoimmune disorders through inflammation and activation of t-cells. in this state, micrornas provide potential to intervene the process through inhibition of il-12 function. thus, synthetic microrna (amirnas) has the ability to inhibit il-12 mediated inflammation. in this research, such a potent therapeutic molecule is designed.

Methods

Transcription intervention can be effective in gene production measures; hence we provide the interfering amirna .the as1 segment of the gene was chosen. using the sidirect software (version 2.0, 2018) three amirna molecules reproduced, considering specifications such as avoiding the gcs, avoiding interference with the coding areas, using "a/u" repeats, and observing the thermodynamic rules, including the difference in the Δg at the beginning and end of the chain.

Results

The result after technical filtration was two suitable sequences: aaaugaaagcgaaauguucgc as guide and gaacauuucgcuuucauuuug as passenger sequences with the lowest off-target possibility of action. the selection was based on the thermodynamic analysis of the native mirna/mirna and mirna/target duplexes and microenvironment spatial probable interferences.

Conclusion

In order to control the clinical phenomena induced by il-12 effects in inflammation and autoimmune processes, blocking of the transcription of this gene would be therapeutically applicable using our designed amirna. the future stages of research include treating the candidate cells with this amirna and evaluation of the interactions with other micro-secretome elements.

Keywords

Autoimmune disorders, mirnas, il 12