Breast cancer is one of the most common cancers and the leading cause of death in women worldwide. several internal and external factors contribute to the development of this cancer. internal factors such as age, hormonal effects, lifestyle, obesity, alcohol consumption, smoking, gender, anxiety and stress, genetic predisposition(mutation in brca1, 2 and other genes).
breast cancer is a multi-stage disease and the viruses can be in one of the stages one have a role. hepatitis b infection is a major global health problem. it is assumed that the potential mechanism of indirect oncogenesis of hepatitis b virus in causing breast cancer through its persistence as occult infection and continuous replication with long term subtle liver damage. hbv may also directly affect the breast cells through hbx which may act as oncoprotein.
this study was performed for 40 tumor paraffin embedded tissues from women in khuzestan province with breast cancer. after extraction of dna with salting out method and amplification of housekeeping gene (beta actin) all samples were examined to detection of dna-hbv virus applying pcr(polymerase chain reaction) method. dna hepatitis b virus in none of the samples was not observed. the presence of hbv gene in a significant subset of women with breast cancer in khuzestan province shows that hepatitis b virus can not on of the reasons for breast cancer. but more studies are needed to demonstrate the relationship between virus and breast cancer.
Methods
This study was performed for 40 tumors paraffin embedded tissues from woman with breast cancer. after extraction of dna with salting out method and amplification of housekeeping gene, all of samples were examined to detection of dna-hbv applying pcr.
to check the accuracy of dna extraction, pcr was performed using two specific primers for housekeeping beta-actin gene with sequence
5ʹ agacgcaggatggcatggg 3ʹ and
5ʹ gagaccttaaacaccccagcc 3ʹ
then pcr was done for evaluation of present hbv genome in tissue samples with two specific
5ʹttgtcctccaacttgtcctg 3ʹ and
5ʹ ccaataccacatcatccatatagc 3ʹ
after multiply dna by pcr, all of the samples from detect dna were electrophoresis.
Results
1-to investigate the quality of dna extraction, about 1 µl of dna is deposited in a nano drop and the amount of dna absorbance was measured at 260 to 280 wavelengths.
2-dna extraction of cancerous samples were used for amplification of beta-actin gene using specific primers. result showed that 39 of the 40 tumor samples were optimally reproduced and the band with a size of 161bp was observed.3-then, tumor samples were used to amplify hepatitis b virus dna by specific primer, non of the samples were not positive for of the hbv infection.
Conclusion
Breast cancer is the second leading cause of death from cancers and almost one in eight women in the united states will be diagnosed with breast cancer in her lifetime. many studies have been conducted to identify the risk factors for this cancer, but known risk factors for less than half of all cases are justifiable and the known molecular mechanisms of breast cancer are very rare. the involvement of various viruses in human breast cancer has been widely studied and very variable results have been reported, some evidence agrees or disagrees with this, so the issue is controversial. few studies, have evaluated the relationship between hbv infection and breast cancer. in the present study, which was performed on the basis of pcr, non of the 40 tumor samples, were positive for hbv infection. further studies are needed to apply our finding to other regions or races and to clarify the underlying pathophysiological mechanisms behind the association of infection viral hepatitis with breast cancer.
